ERCC8 Knockout Cell Line - CD BioSciences

service-banner

ERCC8 Knockout Cell Line

ERCC8 Knockout Cell Line

SPL-01303

Size Price
1 Unit Online Inquiry
Description
14bp deletion
Target Information
Target Name ERCC8
Gene Abbr. ERCC8
Gene ID 1161
Full Name ERCC excision repair 8, CSA ubiquitin ligase complex subunit
Alias CKN1, CSA, UVSS2
Species Human
Genomic Locus chr5:60944972
Transcript NM_000082
WT Expression Level 19.40 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of ERCC8.
Description 14bp deletion
Parental Cell Line C631
Guide RNA Sequence CGCACGCCAAACGGGTTTGG
PCR Primer Forward: CACACAGCATTAGAGGGCAAATAAT
Reverse: CGGATATATCACCGACTGACCAAT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.