Online Inquiry
ERCC8 Knockout Cell Line
SPL-01303
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
14bp deletion |
Target Information | |
---|---|
Target Name | ERCC8 |
Gene Abbr. | ERCC8 |
Gene ID | 1161 |
Full Name | ERCC excision repair 8, CSA ubiquitin ligase complex subunit |
Alias | CKN1, CSA, UVSS2 |
Species | Human |
Genomic Locus | chr5:60944972 |
Transcript | NM_000082 |
WT Expression Level | 19.40 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of ERCC8. |
Description | 14bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CGCACGCCAAACGGGTTTGG |
PCR Primer |
Forward: CACACAGCATTAGAGGGCAAATAAT Reverse: CGGATATATCACCGACTGACCAAT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.