Online Inquiry
ERCC6L2 Knockout Cell Line
SPL-01302
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | ERCC6L2 |
| Gene Abbr. | ERCC6L2 |
| Gene ID | 375748 |
| Full Name | ERCC excision repair 6 like 2 |
| Alias | BMFS2, C9orf102, HEBO, RAD26L, SR278 |
| Species | Human |
| Genomic Locus | chr9:95881225 |
| Transcript | NM_001010895 |
| WT Expression Level | 14.62 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the Snf2 family of helicase-like proteins. The encoded protein may play a role in DNA repair and mitochondrial function. Mutations in this gene have been associated with bone marrow failure syndrome 2. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Apr 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of ERCC6L2. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TATGGACACTACATCCATGG |
| PCR Primer |
Forward: TTTCCCAAACCGAAAATTTCCATCA Reverse: TGAGACAAACACAAACATACACAGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.