ERBB2 Knockout Cell Line - CD BioSciences

service-banner

ERBB2 Knockout Cell Line

ERBB2 Knockout Cell Line

SPL-01289

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name HER2/ErbB2
Gene Abbr. ERBB2
Gene ID 2064
Full Name erb-b2 receptor tyrosine kinase 2
Alias CD340, HER-2, HER-2/neu, HER2, MLN 19
Species Human
Genomic Locus chr17:39708506
Transcript NM_001005862
WT Expression Level 1.99 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of ERBB2.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence TTCGAAGCTGCAGCTCCCGC
PCR Primer Forward: CTCATCGCTCACAACCAAGTGA
Reverse: GAATTATATGTGCTGACGCAAGCTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.