Online Inquiry
EPOR Knockout Cell Line
SPL-01283
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 20bp deletion |
| Target Information | |
|---|---|
| Target Name | EPOR |
| Gene Abbr. | EPOR |
| Gene ID | 2057 |
| Full Name | erythropoietin receptor |
| Alias | EPO-R |
| Species | Human |
| Genomic Locus | chr19:11383179 |
| Transcript | NM_000121 |
| WT Expression Level | 3.76 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes the erythropoietin receptor which is a member of the cytokine receptor family. Upon erythropoietin binding, this receptor activates Jak2 tyrosine kinase which activates different intracellular pathways including: Ras/MAP kinase, phosphatidylinositol 3-kinase and STAT transcription factors. The stimulated erythropoietin receptor appears to have a role in erythroid cell survival. Defects in the erythropoietin receptor may produce erythroleukemia and familial erythrocytosis. Dysregulation of this gene may affect the growth of certain tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of EPOR. |
| Description | 20bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCTGTGCTTCACCGAGCGGT |
| PCR Primer |
Forward: CCTCAAACAGCAGGGGACATAC Reverse: TTTTTCTTATCGGGTCCGCCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.