EPHB6 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

EPHB6 cDNA ORF Clone, Human, untagged

EPHB6 cDNA ORF Clone, Human, untagged

SPD-05325

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human EPH receptor B6.
Target Information
Species Human
Target Name EphB6
Gene Abbr. EPHB6
Gene ID 2051
Full Name EPH receptor B6
Alias HEP
Introduction Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The ephrin receptor encoded by this gene lacks the kinase activity of most receptor tyrosine kinases and binds to ephrin-B ligands.
Product Details
Description Full length Clone DNA of Human EPH receptor B6.
NCBI Ref Seq NM_004445.2
RefSeq ORF Size 3021 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutation 852 C/T which does not result in any amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 3.02kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.