Ephb4 cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Ephb4 cDNA ORF Clone, Mouse, C-His tag

Ephb4 cDNA ORF Clone, Mouse, C-His tag

SPD-05276

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse Eph receptor B4 with C terminal His tag.
Target Information
Species Mouse
Target Name EphB4
Gene Abbr. Ephb4
Gene ID 13846
Full Name Eph receptor B4
Alias AI042935, Htk, MDK2, Myk1, Tyro
Introduction EphB4, also known as Htk, Myk1, Tyro11, and Mdk2, is a member of the Eph receptor family, which binds of the ephrin ligand family. Two classes of receptors exist, designated A and B, that have an extracellular domain made up of a globular domain, a cysteine-rich domain, and two fibronectin type III domains, followed by the transmembrane region and cytoplasmic region. The cytoplasmic region contains juxtamembrane motif with two tyrosines, which are the major autophosphorylation sites, along with a kinase domain, and a conserved sterile alpha motif (SAM) in the carboxyl terminus, which includes one conserved tyrosine. Ligand recognition and binding leads to activation of intrinsic kinase activity. Only membrane-bound or Fc-clustered ligands have been shown to activate the receptor in vitro. Soluble monomeric ligands can bind the receptor, but do not induce receptor autophosphorylation and activation. The Eph receptors and ephrin ligands display reciprocal expression in vivo. Developing and adult neural tissue express nearly all of the Eph receptors and ephrin ligands.Ephs and ephrins play a significant role in angiogenesis.
Product Details
Description Full length Clone DNA of Mouse Eph receptor B4 with C terminal His tag.
NCBI Ref Seq NM_010144.6
RefSeq ORF Size 2964 bp
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.