Online Inquiry
EPHB4 cDNA ORF Clone, Human, C-FLAG tag
SPD-05285
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human EPH receptor B4 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | EphB4 |
Gene Abbr. | EPHB4 |
Gene ID | 2050 |
Full Name | EPH receptor B4 |
Alias | CMAVM2, HFASD, HTK, LMPHM7, MYK1 |
Introduction | EphB4, also known as Htk, Myk1, Tyro11, and Mdk2, is a member of the Eph receptor family, which binds of the ephrin ligand family. Two classes of receptors exist, designated A and B, that have an extracellular domain made up of a globular domain, a cysteine-rich domain, and two fibronectin type III domains, followed by the transmembrane region and cytoplasmic region. The cytoplasmic region contains juxtamembrane motif with two tyrosines, which are the major autophosphorylation sites, along with a kinase domain, and a conserved sterile alpha motif (SAM) in the carboxyl terminus, which includes one conserved tyrosine. Ligand recognition and binding leads to activation of intrinsic kinase activity. Only membrane-bound or Fc-clustered ligands have been shown to activate the receptor in vitro. Soluble monomeric ligands can bind the receptor, but do not induce receptor autophosphorylation and activation. The Eph receptors and ephrin ligands display reciprocal expression in vivo. Developing and adult neural tissue express nearly all of the Eph receptors and ephrin ligands.Ephs and ephrins play a significant role in angiogenesis. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human EPH receptor B4 with C terminal Flag tag. |
NCBI Ref Seq | NM_004444.4 |
RefSeq ORF Size | 2964 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutation 1314 T/C,1752 A/G,1890 C/T, 2934 T/C not causing the amino acid variation. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | HindIII + XbaI (6kb + 3kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.