Online Inquiry
EPHB3 Knockout Cell Line
SPL-01281
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | EphB3 |
| Gene Abbr. | EPHB3 |
| Gene ID | 2049 |
| Full Name | EPH receptor B3 |
| Alias | EK2, ETK2, HEK2, TYRO6 |
| Species | Human |
| Genomic Locus | chr3:184576995 |
| Transcript | NM_004443 |
| WT Expression Level | 2.56 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into two groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. This gene encodes a receptor for ephrin-B family members. [provided by RefSeq, Mar 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of EPHB3. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTTGTCATCACAGCGTGAGC |
| PCR Primer |
Forward: CAGTGGTCCCTTAGCAGGTC Reverse: AGGAGTCTGCCTGGTGAAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.