EPHB3 cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

EPHB3 cDNA ORF Clone, Human, N-Myc tag

EPHB3 cDNA ORF Clone, Human, N-Myc tag

SPD-05272

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human EPH receptor B3 with N terminal Myc tag.
Target Information
Species Human
Target Name EphB3
Gene Abbr. EPHB3
Gene ID 2049
Full Name EPH receptor B3
Alias EK2, ETK2, HEK2, TYRO6
Introduction Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members.
Product Details
Description Full length Clone DNA of Human EPH receptor B3 with N terminal Myc tag.
NCBI Ref Seq NM_004443.3
RefSeq ORF Size 2991 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1047T/C not causing the amino acid variation.
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 2.99kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.