Online Inquiry
EPHB2 Knockout Cell Line
SPL-01280
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 4bp deletion |
| Target Information | |
|---|---|
| Target Name | EphB2 |
| Gene Abbr. | EPHB2 |
| Gene ID | 2048 |
| Full Name | EPH receptor B2 |
| Alias | BDPLT22, CAPB, DRT, EK5, EPHT3 |
| Species | Human |
| Genomic Locus | chr1:22863099 |
| Transcript | NM_017449 |
| WT Expression Level | 7.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors are composed of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. They bind ligands called ephrins and are involved in diverse cellular processes including motility, division, and differentiation. A distinguishing characteristic of Eph-ephrin signaling is that both receptors and ligands are competent to transduce a signaling cascade, resulting in bidirectional signaling. This protein belongs to a subgroup of the Eph receptors called EphB. Proteins of this subgroup are distinguished from other members of the family by sequence homology and preferential binding affinity for membrane-bound ephrin-B ligands. Allelic variants are associated with prostate and brain cancer susceptibility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of EPHB2. |
| Description | 4bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AACAGCCGGACCACTTCTGA |
| PCR Primer |
Forward: ACCCTTCAAGAGATGAGATTTTCCA Reverse: CAATCCTCACTCTGAGCTTTTCTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.