Ephb2 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Ephb2 cDNA ORF Clone, Rat, untagged

Ephb2 cDNA ORF Clone, Rat, untagged

SPD-05244

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat Eph receptor B2.
Target Information
Species Rat
Target Name EphB2
Gene Abbr. Ephb2
Gene ID 313633
Full Name Eph receptor B2
Alias RGD1564232
Introduction Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members.
Product Details
Description Full length Clone DNA of Rat Eph receptor B2.
NCBI Ref Seq NM_001127319.1
RefSeq ORF Size 2961 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.