Ephb1 cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Ephb1 cDNA ORF Clone, Mouse, C-HA tag

Ephb1 cDNA ORF Clone, Mouse, C-HA tag

SPD-05227

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse Eph receptor B1 with C terminal HA tag.
Target Information
Species Mouse
Target Name EphB1
Gene Abbr. Ephb1
Gene ID 270190
Full Name Eph receptor B1
Alias 9330129L11, AW488255, C130099E04Rik, Cek6, El
Introduction EphB6 is a kinase-defective receptor and member of the ephrin-B family of transmembrane proteins. Although lacking kinase activity, EphB6 can regulate cellular functions through its interaction with adaptor proteins and other Eph family members. In hematopoietic cells, EphB6 is specifically expressed in the T cell population and functions as an important regulator of T cell receptor (TCR) mediated signaling. Upon binding with its ephrin-B1 or ephrin-B2 ligand, EphB6 modulates TCR activity through inhibition of JNK signaling, reduction of CD25 expression, and decreased IL-2 secretion. Reduced levels of cell proliferation and cytokine secretion are seen in EphB6 knock-out mice relative to wild type. In conjunction with EphB3 receptor activation, EphB6 suppresses Fas receptor induced apoptosis by triggering the Akt activation pathway. Research indicates that decreased EphB6 expression is associated with a higher degree of metastasis in various cancers, including breast cancer lung cancer and neuroblastoma. EphB6 is thought to reduce cancer invasiveness through its effect on cell adhesion and migration. Following EphrinB1 ligand binding, EphB6 is phosphorylated by kinases such as Src and another active EphB kinase. Phosphorylated EphB6 forms a stable complex with Cbl and initiates Cbl inhibition of cell adhesion. EphB6 regulates signal transduction through direct interaction with other active Eph receptor kinases, sequestering these EphB6-bound receptors and inhibiting typical signal transduction function.
Product Details
Description Full length Clone DNA of Mouse Eph receptor B1 with C terminal HA tag.
NCBI Ref Seq NM_173447.2
RefSeq ORF Size 2997 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1473A/G,2520T/C,2868A/C,2889G/A,2913A/C not causing the amino acid variation.
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites KpnI + NotI (6kb + 3kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.