Online Inquiry
Ephb1 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-05224
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse Eph receptor B1 with C terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | EphB1 |
Gene Abbr. | Ephb1 |
Gene ID | 270190 |
Full Name | Eph receptor B1 |
Alias | 9330129L11, AW488255, C130099E04Rik, Cek6, El |
Introduction | EphB6 is a kinase-defective receptor and member of the ephrin-B family of transmembrane proteins. Although lacking kinase activity, EphB6 can regulate cellular functions through its interaction with adaptor proteins and other Eph family members. In hematopoietic cells, EphB6 is specifically expressed in the T cell population and functions as an important regulator of T cell receptor (TCR) mediated signaling. Upon binding with its ephrin-B1 or ephrin-B2 ligand, EphB6 modulates TCR activity through inhibition of JNK signaling, reduction of CD25 expression, and decreased IL-2 secretion. Reduced levels of cell proliferation and cytokine secretion are seen in EphB6 knock-out mice relative to wild type. In conjunction with EphB3 receptor activation, EphB6 suppresses Fas receptor induced apoptosis by triggering the Akt activation pathway. Research indicates that decreased EphB6 expression is associated with a higher degree of metastasis in various cancers, including breast cancer lung cancer and neuroblastoma. EphB6 is thought to reduce cancer invasiveness through its effect on cell adhesion and migration. Following EphrinB1 ligand binding, EphB6 is phosphorylated by kinases such as Src and another active EphB kinase. Phosphorylated EphB6 forms a stable complex with Cbl and initiates Cbl inhibition of cell adhesion. EphB6 regulates signal transduction through direct interaction with other active Eph receptor kinases, sequestering these EphB6-bound receptors and inhibiting typical signal transduction function. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse Eph receptor B1 with C terminal Flag tag. |
NCBI Ref Seq | NM_173447.2 |
RefSeq ORF Size | 2955 bp |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.