EPHA8 cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

EPHA8 cDNA ORF Clone, Human, N-His tag

EPHA8 cDNA ORF Clone, Human, N-His tag

SPD-05220

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human EPH receptor A8 with N terminal His tag.
Target Information
Species Human
Target Name EphA8
Gene Abbr. EPHA8
Gene ID 2046
Full Name EPH receptor A8
Alias EEK, EK3, HEK3
Introduction EphA8, also known as Eek and Hek3, is a member of the Eph receptor family which binds members of the ephrin ligand family. There are two classes of receptors, designated A and B. Both the A and B class receptors have an extracellular region consisting of a globular domain, a cysteine-rich domain, and two fibronectin type III domains. This is followed by the transmembrane region and cytoplasmic region. The cytoplasmic region contains a juxtamembrane motif with two tyrosine residues, which are the major autophosphorylation sites, a kinase domain, and a conserved sterile alpha motif (SAM) in the carboxy tail which contains one conserved tyrosine residue. Activation of kinase activity occurs after ligand recognition and binding. EphA8 has been shown to bind ephrin‑A5, ephrin‑A3, and ephrin‑A2.
Product Details
Description Full length Clone DNA of Human EPH receptor A8 with N terminal His tag.
NCBI Ref Seq NM_020526.3
RefSeq ORF Size 3018 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.