Online Inquiry
EPHA7 cDNA ORF Clone, Human, N-Myc tag
SPD-05211
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human EPH receptor A7 with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | EphA7 |
| Gene Abbr. | EPHA7 |
| Gene ID | 2045 |
| Full Name | EPH receptor A7 |
| Alias | EHK-3, EHK3, EK11, HEK11 |
| Introduction | The Eph receptors are the largest known family of receptor tyrosine kinases (RTKs). They can be divided into two groups based on sequence similarity and on their preference for a subset of ligands: EphA receptors bind to a glycosylphosphatidylinositol-anchored ephrin A ligand; EphB receptors bind to ephrin B proteins that have a transmembrane and cytoplasmic domain. Research studies have shown that Eph receptors and ligands may be involved in many diseases including cancer. Both ephrin A and B ligands have dual functions. As RTK ligands, ephrins stimulate the kinase activity of Eph receptors and activate signaling pathways in receptor-expressing cells. The ephrin extracellular domain is sufficient for this function as long as it is clustered. The second function of ephrins has been described as "reverse signaling", whereby the cytoplasmic domain becomes tyrosine phosphorylated, allowing interactions with other proteins that may activate signaling pathways in the ligand-expressing cells. Various stimuli can induce tyrosine phosphorylation of ephrin B, including binding to EphB receptors, activation of Src kinase, and stimulation by PDGF and FGF. Tyr324 and Tyr327 have been identified as major phosphorylation sites of ephrin B1 in vivo.EphB1 is a member of the Eph family of receptor tyrosine kinases that plays an important role in diverse biological processes including nervous system development, angiogenesis, and neural synapsis formation and maturation. Over- or underexpression of certain Eph receptors has been found in some cancer tissues. EphB1 has been shown to be involved in the tumorigenesis of colorectal cancer. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human EPH receptor A7 with N terminal Myc tag. |
| NCBI Ref Seq | NM_004440.3 |
| RefSeq ORF Size | 2997 bp |
| Vector | pCMV3-SP-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.