Online Inquiry
Epha6 cDNA ORF Clone, Mouse, C-His tag
SPD-05175
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse Eph receptor A6 with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | EphA6 |
Gene Abbr. | Epha6 |
Gene ID | 13840 |
Full Name | Eph receptor A6 |
Alias | Ehk2, Hek12, m-ehk2 |
Introduction | EphA6, also known as Ehk2 and Hek12, is a member of the Eph receptor family which binds members of the ephrin ligand family. There are two classes of receptors, designated A and B. Both the A and B class receptors have an extracellular region consisting of a globular domain, a cysteine-rich domain, and two fibronectin type III domains. This is followed by the transmembrane region and cytoplasmic region. The cytoplasmic region contains a juxtamembrane motif with two tyrosine residues, which are the major autophosphorylation sites, a kinase domain, and a conserved sterile alpha motif (SAM) in the carboxy tail which contains one conserved tyrosine residue. Activation of kinase activity occurs after ligand recognition and binding. EphA6 has been shown to bind ephrin-A2, ephrin-A1, ephrin-A3, ephrin-A4, and ephrin-A5. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse Eph receptor A6 with C terminal His tag. |
NCBI Ref Seq | NM_007938.2 |
RefSeq ORF Size | 3108 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.