Epha6 cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Epha6 cDNA ORF Clone, Mouse, C-HA tag

Epha6 cDNA ORF Clone, Mouse, C-HA tag

SPD-05177

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse Eph receptor A6 with C terminal HA tag.
Target Information
Species Mouse
Target Name EphA6
Gene Abbr. Epha6
Gene ID 13840
Full Name Eph receptor A6
Alias Ehk2, Hek12, m-ehk2
Introduction EphA6, also known as Ehk2 and Hek12, is a member of the Eph receptor family which binds members of the ephrin ligand family. There are two classes of receptors, designated A and B. Both the A and B class receptors have an extracellular region consisting of a globular domain, a cysteine-rich domain, and two fibronectin type III domains. This is followed by the transmembrane region and cytoplasmic region. The cytoplasmic region contains a juxtamembrane motif with two tyrosine residues, which are the major autophosphorylation sites, a kinase domain, and a conserved sterile alpha motif (SAM) in the carboxy tail which contains one conserved tyrosine residue. Activation of kinase activity occurs after ligand recognition and binding. EphA6 has been shown to bind ephrin-A2, ephrin-A1, ephrin-A3, ephrin-A4, and ephrin-A5.
Product Details
Description Full length Clone DNA of Mouse Eph receptor A6 with C terminal HA tag.
NCBI Ref Seq NM_007938.2
RefSeq ORF Size 3108 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.