EPHA6 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

EPHA6 cDNA ORF Clone, Human, C-FLAG tag

EPHA6 cDNA ORF Clone, Human, C-FLAG tag

SPD-05184

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human EPH receptor A6 with C terminal Flag tag.
Target Information
Species Human
Target Name EphA6
Gene Abbr. EPHA6
Gene ID 285220
Full Name EPH receptor A6
Alias EHK-2, EHK2, EK12, EPA6, HEK12
Introduction EphA6, also known as Ehk2 and Hek12, is a member of the Eph receptor family which binds members of the ephrin ligand family. There are two classes of receptors, designated A and B. Both the A and B class receptors have an extracellular region consisting of a globular domain, a cysteine-rich domain, and two fibronectin type III domains. This is followed by the transmembrane region and cytoplasmic region. The cytoplasmic region contains a juxtamembrane motif with two tyrosine residues, which are the major autophosphorylation sites, a kinase domain, and a conserved sterile alpha motif (SAM) in the carboxy tail which contains one conserved tyrosine residue. Activation of kinase activity occurs after ligand recognition and binding. EphA6 has been shown to bind ephrin-A2, ephrin-A1, ephrin-A3, ephrin-A4, and ephrin-A5.
Product Details
Description Full length Clone DNA of Human EPH receptor A6 with C terminal Flag tag.
NCBI Ref Seq NM_173655.2
RefSeq ORF Size 1044 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.04kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.