EPHA4 cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

EPHA4 cDNA ORF Clone, Rhesus, untagged

EPHA4 cDNA ORF Clone, Rhesus, untagged

SPD-05143

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus EPH receptor A4.
Target Information
Species Rhesus
Target Name EphA4
Gene Abbr. EPHA4
Gene ID 704857
Full Name EPH receptor A4
Introduction This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Rhesus EPH receptor A4.
NCBI Ref Seq XM_001106493.2
RefSeq ORF Size 2961 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.