Epha4 cDNA ORF Clone, Rat, C-Myc tag - CD BioSciences

service-banner

Epha4 cDNA ORF Clone, Rat, C-Myc tag

Epha4 cDNA ORF Clone, Rat, C-Myc tag

SPD-05146

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat Eph receptor A4 with C terminal Myc tag.
Target Information
Species Rat
Target Name EphA4
Gene Abbr. Epha4
Gene ID 316539
Full Name Eph receptor A4
Alias RGD1560587
Introduction This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Rat Eph receptor A4 with C terminal Myc tag.
NCBI Ref Seq NM_001162411.1
RefSeq ORF Size 2961 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.