Online Inquiry
Epha4 cDNA ORF Clone, Mouse, N-FLAG tag
SPD-05159
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse Eph receptor A4 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | EphA4 |
Gene Abbr. | Epha4 |
Gene ID | 13838 |
Full Name | Eph receptor A4 |
Alias | 2900005C20Rik, AI385584, Cek8, Hek8, Se |
Introduction | This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse Eph receptor A4 with N terminal Flag tag. |
NCBI Ref Seq | NM_007936.3 |
RefSeq ORF Size | 2961 bp |
Vector | pCMV3-SP-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.