EPHA3 Knockout Cell Line - CD BioSciences

service-banner

EPHA3 Knockout Cell Line

EPHA3 Knockout Cell Line

SPL-01271

Size Price
1 Unit Online Inquiry
Description
13bp deletion
Target Information
Target Name EphA3
Gene Abbr. EPHA3
Gene ID 2042
Full Name EPH receptor A3
Alias EK4, ETK, ETK1, HEK, HEK4
Species Human
Genomic Locus chr3:89107785
Transcript NM_005233
WT Expression Level 2.42 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of EPHA3.
Description 13bp deletion
Parental Cell Line C631
Guide RNA Sequence TGCTCTGTTCTCGACAGCTT
PCR Primer Forward: CCTCCTTATCTCCAGTGTCAAACTT
Reverse: AAAAAGGCACATCTTTCCTTCACTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.