Online Inquiry
EPHA2 cDNA ORF Clone, Human, N-FLAG tag
SPD-05119
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human EPH receptor A2 with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | EphA2 |
| Gene Abbr. | EPHA2 |
| Gene ID | 1969 |
| Full Name | EPH receptor A2 |
| Alias | ARCC2, CTPA, CTPP1, CTRCT6, ECK |
| Introduction | The Eph receptors are the largest known family of receptor tyrosine kinases (RTKs). They can be divided into two groups based on sequence similarity and on their preference for a subset of ligands. While EphA receptors bind to a glycosylphosphatidylinositol-anchored ephrin A ligand, EphB receptors bind to ephrin B proteins that have a transmembrane and cytoplasmic domain. Research studies have shown that Eph receptors and ligands may be involved in many diseases including cancer. Both ephrin A and B ligands have dual functions. As RTK ligands, ephrins stimulate the kinase activity of Eph receptors and activate signaling pathways in receptor-expressing cells. The ephrin extracellular domain is sufficient for this function as long as it is clustered. The second function of ephrins has been described as "reverse signaling", whereby the cytoplasmic domain becomes tyrosine phosphorylated, allowing interactions with other proteins that may activate signaling pathways in the ligand-expressing cells.The EphA3 receptor preferentially binds ephrin-A5. This ligand-receptor interaction stimulates EphA3 signaling, regulates cell adhesion and migration, and induces cellular morphologic responses. EphA3 plays a critical role in callosal axon guidance retinotectal mapping of neurons as well as cardiac cell migration and differentiation. Investigators have shown that somatic mutations in functional domains of EphA3 are linked to lung cancer progression. In addition, EphA3 expression levels have been correlated with tumor angiogenesis and progression in gastric and colorectal carcinoma.Both Tyr602 and Tyr779 phosphorylation are involved in ephrin-A5 induced EphA3 receptor activation. Phosphorylated Tyr779 of the EphA3 receptor is the binding site for the SH2-domain-containing Crk adaptor, which in turn activates the small GTPase RhoA. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human EPH receptor A2 with N terminal Flag tag. |
| NCBI Ref Seq | NM_004431.2 |
| RefSeq ORF Size | 2949 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-SP-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6kb + 2.95kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.