Online Inquiry
Epha1 cDNA ORF Clone, Mouse, C-HA tag
SPD-05087
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse Eph receptor A1 with C terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | EphA1 |
Gene Abbr. | Epha1 |
Gene ID | 13835 |
Full Name | Eph receptor A1 |
Alias | 5730453L17Rik, AL033318, Ep, Eph, Es |
Introduction | The Eph receptors are the largest known family of receptor tyrosine kinases (RTKs). They can be divided into two groups based on sequence similarity and on their preference for a subset of ligands: EphA receptors bind to a glycosylphosphatidylinositol-anchored ephrin A ligand; EphB receptors bind to ephrin B proteins that have a transmembrane and cytoplasmic domain. Research studies have shown that Eph receptors and ligands may be involved in many diseases including cancer. Both ephrin A and B ligands have dual functions. As RTK ligands, ephrins stimulate the kinase activity of Eph receptors and activate signaling pathways in receptor-expressing cells. The ephrin extracellular domain is sufficient for this function as long as it is clustered. The second function of ephrins has been described as "reverse signaling", whereby the cytoplasmic domain becomes tyrosine phosphorylated, allowing interactions with other proteins that may activate signaling pathways in the ligand-expressing cells. Various stimuli can induce tyrosine phosphorylation of ephrin B, including binding to EphB receptors, activation of Src kinase, and stimulation by PDGF and FGF. Tyr324 and Tyr327 have been identified as major phosphorylation sites of ephrin B1 in vivo.EphA2 is overexpressed in various tumor cells, and it has been suggested that EphA2 may promote malignancy. However, several studies demonstrate that EphA2 plays an important role in tumor suppression. The role of EphA2 in tumor development may depend upon regulation of its tyrosine kinase activity. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse Eph receptor A1 with C terminal HA tag. |
NCBI Ref Seq | NM_023580.4 |
RefSeq ORF Size | 2934 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.