EPHA1 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

EPHA1 cDNA ORF Clone, Human, N-HA tag

EPHA1 cDNA ORF Clone, Human, N-HA tag

SPD-05102

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human EPH receptor A1 with N terminal HA tag.
Target Information
Species Human
Target Name EphA1
Gene Abbr. EPHA1
Gene ID 2041
Full Name EPH receptor A1
Alias EPH, EPHT, EPHT1
Introduction The Eph receptors are the largest known family of receptor tyrosine kinases (RTKs). They can be divided into two groups based on sequence similarity and on their preference for a subset of ligands: EphA receptors bind to a glycosylphosphatidylinositol-anchored ephrin A ligand; EphB receptors bind to ephrin B proteins that have a transmembrane and cytoplasmic domain. Research studies have shown that Eph receptors and ligands may be involved in many diseases including cancer. Both ephrin A and B ligands have dual functions. As RTK ligands, ephrins stimulate the kinase activity of Eph receptors and activate signaling pathways in receptor-expressing cells. The ephrin extracellular domain is sufficient for this function as long as it is clustered. The second function of ephrins has been described as "reverse signaling", whereby the cytoplasmic domain becomes tyrosine phosphorylated, allowing interactions with other proteins that may activate signaling pathways in the ligand-expressing cells. Various stimuli can induce tyrosine phosphorylation of ephrin B, including binding to EphB receptors, activation of Src kinase, and stimulation by PDGF and FGF. Tyr324 and Tyr327 have been identified as major phosphorylation sites of ephrin B1 in vivo.EphA2 is overexpressed in various tumor cells, and it has been suggested that EphA2 may promote malignancy. However, several studies demonstrate that EphA2 plays an important role in tumor suppression. The role of EphA2 in tumor development may depend upon regulation of its tyrosine kinase activity.
Product Details
Description Full length Clone DNA of Human EPH receptor A1 with N terminal HA tag.
NCBI Ref Seq NM_005232.4
RefSeq ORF Size 2931 bp
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.