Online Inquiry
ELK1 cDNA ORF Clone, Human, untagged
SPD-05063
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human ELK1, ETS transcription factor. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Elk-1 |
| Gene Abbr. | ELK1 |
| Gene ID | 2002 |
| Full Name | ETS transcription factor ELK1 |
| Introduction | The transcription factor Elk-1 is a component of the ternary complex that binds the serum response element (SRE) and mediates gene activity in response to serum and growth factors. Elk-1 is phosphorylated by MAP kinase pathways at a cluster of S/T motifs at its carboxy terminus; phosphorylation at these sites, particularly Ser383, is critical for transcriptional activation by Elk-1. Elk-1 appears to be a direct target of activated MAP kinase: (a) biochemical studies indicate that Elk-1 is a good substrate for MAP kinase; (b) the kinetics of Elk-1 phosphorylation and activation correlate with MAP kinase activity; (c) interfering mutants of MAP kinase block Elk-1 activation in vivo. Other studies have shown that Elk-1 (Ser383) is also a target of the stress-activated kinase SAPK/JNK. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human ELK1, ETS transcription factor. |
| NCBI Ref Seq | NM_001114123.2 |
| RefSeq ORF Size | 1287 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.29kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.