Online Inquiry
Elavl1 cDNA ORF Clone, Mouse, N-Myc tag
SPD-05053
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R) with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | ELAVL1/HuR |
| Gene Abbr. | Elavl1 |
| Gene ID | 15568 |
| Full Name | ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R) |
| Alias | 2410055N02Rik, HUR, Hu, Hua, W91709 |
| Introduction | The ELAVL (embryonic lethal, abnormal vision and Drosophila-like) family of proteins includes ELAVL1/HuR, ELAVL2/HuB, ELAVL3/HuC and ELAVL4/HuD. ELAVL1/HuR is ubiquitously expressed whereas expression of the other three members is neuronal-specific. ELAVL/Hu proteins are highly conserved RNA-binding proteins. Besides three RNA recognition motifs, these proteins also contain nuclear localization signals that enable them to shuttle between nucleus and cytoplasm. Upon inhibition of transcription by actinomycin D, ELAVL1/HuR relocates from nucleus to cytoplasm where it binds the AU-rich elements within 3' UTRs to stabilize mRNAs. ELAVL1/HuR is suggested to increase translation by binding to mRNAs. In addition, ELAVL1/HuR interacts with microRNAs (miRNAs). |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R) with N terminal Myc tag. |
| NCBI Ref Seq | NM_010485.3 |
| RefSeq ORF Size | 981 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.