Elavl1 cDNA ORF Clone, Mouse, N-FLAG tag - CD BioSciences

service-banner

Elavl1 cDNA ORF Clone, Mouse, N-FLAG tag

Elavl1 cDNA ORF Clone, Mouse, N-FLAG tag

SPD-05051

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R) with N terminal Flag tag.
Target Information
Species Mouse
Target Name ELAVL1/HuR
Gene Abbr. Elavl1
Gene ID 15568
Full Name ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R)
Alias 2410055N02Rik, HUR, Hu, Hua, W91709
Introduction The ELAVL (embryonic lethal, abnormal vision and Drosophila-like) family of proteins includes ELAVL1/HuR, ELAVL2/HuB, ELAVL3/HuC and ELAVL4/HuD. ELAVL1/HuR is ubiquitously expressed whereas expression of the other three members is neuronal-specific. ELAVL/Hu proteins are highly conserved RNA-binding proteins. Besides three RNA recognition motifs, these proteins also contain nuclear localization signals that enable them to shuttle between nucleus and cytoplasm. Upon inhibition of transcription by actinomycin D, ELAVL1/HuR relocates from nucleus to cytoplasm where it binds the AU-rich elements within 3' UTRs to stabilize mRNAs. ELAVL1/HuR is suggested to increase translation by binding to mRNAs. In addition, ELAVL1/HuR interacts with microRNAs (miRNAs).
Product Details
Description Full length Clone DNA of Mouse ELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R) with N terminal Flag tag.
NCBI Ref Seq NM_010485.3
RefSeq ORF Size 981 bp
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.