Online Inquiry
EIF5 cDNA ORF Clone, Human, N-Myc tag
SPD-05044
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human eukaryotic translation initiation factor 5 with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | eIF5 |
| Gene Abbr. | EIF5 |
| Gene ID | 1983 |
| Full Name | eukaryotic translation initiation factor 5 |
| Alias | EIF-5, EIF-5A |
| Introduction | Eukaryotic translation initiation factor 5 (eIF5) is crucial for the assembly of translation initiation complex and plays an important role in protein synthesis. eIF5 interacts with the 43S initiation complex to stimulate hydrolysis of GTP bound to eIF2. Studies suggest that eIF5 functions as the GTPase-activating protein (GAP) in the hydrolysis of GTP-bound eIF2. This hydrolysis leads to the release of initiation factors from the 40S ribosomal subunit, which is a necessary step in the formation of the 80S initiation complex. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human eukaryotic translation initiation factor 5 with N terminal Myc tag. |
| NCBI Ref Seq | BC007728 |
| RefSeq ORF Size | 1296 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.