EIF5 cDNA ORF Clone, Human, N-His tag - CD BioSciences

service-banner

EIF5 cDNA ORF Clone, Human, N-His tag

EIF5 cDNA ORF Clone, Human, N-His tag

SPD-05043

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 5 with N terminal His tag.
Target Information
Species Human
Target Name eIF5
Gene Abbr. EIF5
Gene ID 1983
Full Name eukaryotic translation initiation factor 5
Alias EIF-5, EIF-5A
Introduction Eukaryotic translation initiation factor 5 (eIF5) is crucial for the assembly of translation initiation complex and plays an important role in protein synthesis. eIF5 interacts with the 43S initiation complex to stimulate hydrolysis of GTP bound to eIF2. Studies suggest that eIF5 functions as the GTPase-activating protein (GAP) in the hydrolysis of GTP-bound eIF2. This hydrolysis leads to the release of initiation factors from the 40S ribosomal subunit, which is a necessary step in the formation of the 80S initiation complex.
Product Details
Description Full length Clone DNA of Human eukaryotic translation initiation factor 5 with N terminal His tag.
NCBI Ref Seq BC007728
RefSeq ORF Size 1296 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.