Online Inquiry
EIF4EBP1 Knockout Cell Line
SPL-01254
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | 4EBP |
| Gene Abbr. | EIF4EBP1 |
| Gene ID | 1978 |
| Full Name | eukaryotic translation initiation factor 4E binding protein 1 |
| Alias | 4E-BP1, 4EBP1, BP-1, PHAS-I |
| Species | Human |
| Genomic Locus | chr8:38030689 |
| Transcript | NM_004095 |
| WT Expression Level | 125.29 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes one member of a family of translation repressor proteins. The protein directly interacts with eukaryotic translation initiation factor 4E (eIF4E), which is a limiting component of the multisubunit complex that recruits 40S ribosomal subunits to the 5' end of mRNAs. Interaction of this protein with eIF4E inhibits complex assembly and represses translation. This protein is phosphorylated in response to various signals including UV irradiation and insulin signaling, resulting in its dissociation from eIF4E and activation of mRNA translation. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of EIF4EBP1. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGTGCTGAAGAGCGTGCCGC |
| PCR Primer |
Forward: TGACACCTAACAGAAAGAGGAAACA Reverse: AGCGCACAGGAGACCATGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.