Online Inquiry
Eif4e cDNA ORF Clone, Mouse, N-HA tag
SPD-05024
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse Eukaryotic translation initiation factor 4E-binding protein 1 with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | eIF4E |
| Gene Abbr. | Eif4e |
| Gene ID | 13684 |
| Full Name | eukaryotic translation initiation factor 4E |
| Alias | EG668879, Eif4e-ps, If4, If4e, eIF-4 |
| Introduction | Eukaryotic initiation factor 4E (eIF4E) binds to the mRNA cap structure to mediate the initiation of translation. eIF4E interacts with eIF4G, a scaffold protein that promotes assembly of eIF4E and eIF4A into the eIF4F complex. eIF4B is thought to assist the eIF4F complex in translation initiation. Upon activation by mitogenic and/or stress stimuli mediated by Erk and p38 MAPK, Mnk1 phosphorylates eIF4E at Ser209 in vivo. Two Erk and p38 MAPK phosphorylation sites in mouse Mnk1 (Thr197 and Thr202) are essential for Mnk1 kinase activity. The carboxy-terminal region of eIF4G also contains serum-stimulated phosphorylation sites, including Ser1108, Ser1148, and Ser1192. Phosphorylation at these sites is blocked by the PI3 kinase inhibitor LY294002 and by the FRAP/mTOR inhibitor rapamycin. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse Eukaryotic translation initiation factor 4E-binding protein 1 with N terminal HA tag. |
| NCBI Ref Seq | NM_007918.3 |
| RefSeq ORF Size | 396 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 0.4kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.