Online Inquiry
Eif4b cDNA ORF Clone, Mouse, N-Myc tag
SPD-05002
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse eukaryotic translation initiation factor 4B with N terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | eIF4B |
Gene Abbr. | Eif4b |
Gene ID | 75705 |
Full Name | eukaryotic translation initiation factor 4B |
Alias | 2310046H11Rik, AL024095, C85189, Eif4a2 |
Introduction | Eukaryotic initiation factor 4B (eIF4B) is thought to assist the eIF4F complex in translation initiation. In plants, eIF4B is known to interact with the poly-(A) binding protein, increasing its poly-(A) binding activity. Heat shock and serum starvation cause dephosphorylation of eIF4B at multiple sites with kinetics similar to those of the corresponding inhibition of translation, while phosphorylation of eIF4B following insulin treatment correlates well with an observed increase in translation. Multiple kinases, including p70 S6 kinase, can phosphorylate eIF4B in vitro, and at least one serum-inducible eIF4B phosphorylation site is sensitive to rapamycin and LY294002. Recently, Ser406 was identified as a novel phosphorylation site regulated by mitogens and the phosphorylation of this site is dependent on MEK and mTOR activity. This phosphorylation is shown to be essential for the translational activity of eIF4B. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse eukaryotic translation initiation factor 4B with N terminal Myc tag. |
NCBI Ref Seq | NM_145625.3 |
RefSeq ORF Size | 1836 bp |
Vector | pCMV3-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.