EIF4B cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

EIF4B cDNA ORF Clone, Human, N-Myc tag

EIF4B cDNA ORF Clone, Human, N-Myc tag

SPD-05013

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 4B with N terminal Myc tag.
Target Information
Species Human
Target Name eIF4B
Gene Abbr. EIF4B
Gene ID 1975
Full Name eukaryotic translation initiation factor 4B
Alias EIF-4B, PRO1843
Introduction Eukaryotic initiation factor 4B (eIF4B) is thought to assist the eIF4F complex in translation initiation. In plants, eIF4B is known to interact with the poly-(A) binding protein, increasing its poly-(A) binding activity. Heat shock and serum starvation cause dephosphorylation of eIF4B at multiple sites with kinetics similar to those of the corresponding inhibition of translation, while phosphorylation of eIF4B following insulin treatment correlates well with an observed increase in translation. Multiple kinases, including p70 S6 kinase, can phosphorylate eIF4B in vitro, and at least one serum-inducible eIF4B phosphorylation site is sensitive to rapamycin and LY294002. Recently, Ser406 was identified as a novel phosphorylation site regulated by mitogens and the phosphorylation of this site is dependent on MEK and mTOR activity. This phosphorylation is shown to be essential for the translational activity of eIF4B.
Product Details
Description Full length Clone DNA of Human eukaryotic translation initiation factor 4B with N terminal Myc tag.
NCBI Ref Seq BC073139
RefSeq ORF Size 1836 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.