Online Inquiry
EIF2AK2 Knockout Cell Line
SPL-01249
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
4bp deletion |
Target Information | |
---|---|
Target Name | PKR |
Gene Abbr. | EIF2AK2 |
Gene ID | 5610 |
Full Name | eukaryotic translation initiation factor 2 alpha kinase 2 |
Alias | EIF2AK1, LEUDEN, PKR, PPP1R83, PRKR |
Species | Human |
Genomic Locus | chr2:37146874 |
Transcript | NM_001135651 |
WT Expression Level | 23.22 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of EIF2AK2. |
Description | 4bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CTCAACAGCTAATTTGGCTG |
PCR Primer |
Forward: ACTGTTTGAGGTGACTGCTTAAATG Reverse: TTGAATGTAAGGGAACGTGTGAATG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.