Online Inquiry
EHMT2 Knockout Cell Line
SPL-01243
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 34bp deletion |
| Target Information | |
|---|---|
| Target Name | G9a/EHMT2 |
| Gene Abbr. | EHMT2 |
| Gene ID | 10919 |
| Full Name | euchromatic histone lysine methyltransferase 2 |
| Alias | BAT8, C6orf30, G9A, GAT8, KMT1C |
| Species | Human |
| Genomic Locus | chr6:31896781 |
| Transcript | NM_006709 |
| WT Expression Level | 32.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 34bp deletion in a coding exon of EHMT2. |
| Description | 34bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAGGGTTTCTTCACTACGAG |
| PCR Primer |
Forward: TCCCTCAAGATTCTCAGATTCATCC Reverse: GAGAGAGGTGAGTGCAGCTAAAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.