Egr1 cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Egr1 cDNA ORF Clone, Mouse, C-FLAG tag

Egr1 cDNA ORF Clone, Mouse, C-FLAG tag

SPD-04982

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse early growth response 1 with C terminal Flag tag.
Target Information
Species Mouse
Target Name EGR1
Gene Abbr. Egr1
Gene ID 13653
Full Name early growth response 1
Alias A530045N19Rik, ETR10, ETR103, Egr-, Egr-1
Introduction EGR family members are transcriptional factors that contain three repetitive zinc finger DNA binding domains which bind to EGR response elements (ER) to regulate target gene expression. The expression of EGR family members is induced by growth factors, with EGR1 expression being induced by NGF. Increased EGR1 expression activates transcription of other signaling molecules, including CDK5 and tyrosine hydroxylase, and exerts long term effects on neural cell growth and differentiation.
Product Details
Description Full length Clone DNA of Mouse early growth response 1 with C terminal Flag tag.
NCBI Ref Seq NM_007913.5
RefSeq ORF Size 1641 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.64kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.