Online Inquiry
EGR1 cDNA ORF Clone, Human, C-His tag
SPD-04992
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human early growth response 1 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | EGR1 |
| Gene Abbr. | EGR1 |
| Gene ID | 1958 |
| Full Name | early growth response 1 |
| Alias | AT225, G0S30, KROX-24, NGFI-A, TIS8 |
| Introduction | EGR family members are transcriptional factors that contain three repetitive zinc finger DNA binding domains which bind to EGR response elements (ER) to regulate target gene expression. The expression of EGR family members is induced by growth factors, with EGR1 expression being induced by NGF. Increased EGR1 expression activates transcription of other signaling molecules, including CDK5 and tyrosine hydroxylase, and exerts long term effects on neural cell growth and differentiation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human early growth response 1 |
| NCBI Ref Seq | NM_001964.2 |
| RefSeq ORF Size | 1677 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | KpnI + XbaI (6kb + 1.68kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.