EGFL8 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

EGFL8 cDNA ORF Clone, Human, untagged

EGFL8 cDNA ORF Clone, Human, untagged

SPD-04921

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human EGF-like-domain, multiple 8.
Target Information
Species Human
Target Name EGFL8
Gene Abbr. EGFL8
Gene ID 80864
Full Name EGF like domain multiple 8
Alias C6orf8, NG3
Product Details
Description Full length Clone DNA of Human EGF-like-domain, multiple 8.
NCBI Ref Seq BC035574
RefSeq ORF Size 882 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.