Egfl7 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Egfl7 cDNA ORF Clone, Mouse, untagged

Egfl7 cDNA ORF Clone, Mouse, untagged

SPD-04900

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse EGF-like domain 7.
Target Information
Species Mouse
Target Name EGFL7
Gene Abbr. Egfl7
Gene ID 353156
Full Name EGF-like domain 7
Alias VE-s, VE-statin, Zneu, Zneu1
Product Details
Description Full length Clone DNA of Mouse EGF-like domain 7.
NCBI Ref Seq NM_178444.3
RefSeq ORF Size 825 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.83kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.