Online Inquiry
EGFL6 Knockout Cell Line
SPL-01209
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 31bp deletion |
| Target Information | |
|---|---|
| Target Name | EGFL6 |
| Gene Abbr. | EGFL6 |
| Gene ID | 25975 |
| Full Name | EGF like domain multiple 6 |
| Alias | MAEG, W80 |
| Species | Human |
| Genomic Locus | chrX:13600003 |
| Transcript | NM_001167890 |
| WT Expression Level | 0.07 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the epidermal growth factor (EGF) repeat superfamily. Members of this superfamily are characterized by the presence of EGF-like repeats and are often involved in the regulation of cell cycle, proliferation, and developmental processes. The gene product contains a signal peptide, suggesting that it is secreted; an EGF repeat region consisting of 4 complete EGF-like repeats and 1 partial EGF-like repeat, 3 of which have a calcium-binding consensus sequence; an arg-gly-asp integrin association motif; and a MAM domain, which is believed to have an adhesive function. This gene is expressed early during development, and its expression has been detected in lung and meningioma tumors. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 31bp deletion in a coding exon of EGFL6. |
| Description | 31bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACATCTGTGTTGGCATGGC |
| PCR Primer |
Forward: GAATTTGATGGTCAGAGAGAAGGTG Reverse: TTTTAGCTGGGGGCAATATTAGAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.