Online Inquiry
EEF2K cDNA ORF Clone, Human, C-FLAG tag
SPD-04849
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human eukaryotic elongation factor-2 kinase with C terminal Flag tag. |
Target Information | |
---|---|
Species | Human |
Target Name | eEF2K |
Gene Abbr. | EEF2K |
Gene ID | 29904 |
Full Name | eukaryotic elongation factor 2 kinase |
Alias | CaMKIII, HSU93850, eEF-2K |
Introduction | Eukaryotic elongation factor 2 kinase (eEF2k) phosphorylates and inactivates eEF2, resulting in the inhibition of peptide-chain elongation. eEF2k is normally dependent on Ca2+ ions and calmodulin. It can be activated by PKA in response to elevated cAMP levels, which are generally increased in stress- or starvation-related conditions. eEF2k can also be regulated in response to a wide range of stimuli that promote cell growth and protein synthesis. This involves the phosphorylation of eEF2k by p90RSK and p70 S6 kinase at Ser366 or by SAPK4/p38delta at Ser359, leading to the inactivation of eEF2k, which facilitates the dephosphorylation of eEF2, and thus promotes translation. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human eukaryotic elongation factor-2 kinase with C terminal Flag tag. |
NCBI Ref Seq | NM_013302.3 |
RefSeq ORF Size | 2217 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1620C/T not causing the amino acid variation. |
Vector | pCMV3-C-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Restriction Sites | KpnI + NotI (6kb + 2.22kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.