Online Inquiry
Eef2 cDNA ORF Clone, Mouse, N-FLAG tag
SPD-04833
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse eukaryotic translation elongation factor 2 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | eEF2 |
Gene Abbr. | Eef2 |
Gene ID | 13629 |
Full Name | eukaryotic translation elongation factor 2 |
Alias | Ef-2 |
Introduction | Eukaryotic elongation factor 2 (eEF2) catalyzes the translocation of peptidyl-tRNA from the A site to the P site on the ribosome. It has been shown that phosphorylation of eEF2 at threonine 56 by eEF2 kinase inhibits its activity. eEF2 kinase is normally dependent on Ca2+ ions and calmodulin. eEF2 kinase can also be activated by PKA in response to elevated cAMP levels, which are generally increased in stress- or starvation-related conditions. A variety of treatments known to raise intracellular Ca2+ or cAMP levels have been shown to result in increased phosphorylation of eEF2, and thus to inhibit peptide-chain elongation. The inactive phosphorylated eEF2 can be converted to its active nonphosphorylated form by a protein phosphatase, most likely a form of protein phosphatase-2A. Insulin, which activates protein synthesis in a wide range of cell types, induces rapid dephosphorylation of eEF2 through mTOR signaling and may involve modulation of the activity of the PP-2A or the eEF2 kinase or both. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse eukaryotic translation elongation factor 2 with N terminal Flag tag. |
NCBI Ref Seq | NM_007907.2 |
RefSeq ORF Size | 2577 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.