Eef2 cDNA ORF Clone, Mouse, C-HA tag - CD BioSciences

service-banner

Eef2 cDNA ORF Clone, Mouse, C-HA tag

Eef2 cDNA ORF Clone, Mouse, C-HA tag

SPD-04832

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse eukaryotic translation elongation factor 2 with C terminal HA tag.
Target Information
Species Mouse
Target Name eEF2
Gene Abbr. Eef2
Gene ID 13629
Full Name eukaryotic translation elongation factor 2
Alias Ef-2
Introduction Eukaryotic elongation factor 2 (eEF2) catalyzes the translocation of peptidyl-tRNA from the A site to the P site on the ribosome. It has been shown that phosphorylation of eEF2 at threonine 56 by eEF2 kinase inhibits its activity. eEF2 kinase is normally dependent on Ca2+ ions and calmodulin. eEF2 kinase can also be activated by PKA in response to elevated cAMP levels, which are generally increased in stress- or starvation-related conditions. A variety of treatments known to raise intracellular Ca2+ or cAMP levels have been shown to result in increased phosphorylation of eEF2, and thus to inhibit peptide-chain elongation. The inactive phosphorylated eEF2 can be converted to its active nonphosphorylated form by a protein phosphatase, most likely a form of protein phosphatase-2A. Insulin, which activates protein synthesis in a wide range of cell types, induces rapid dephosphorylation of eEF2 through mTOR signaling and may involve modulation of the activity of the PP-2A or the eEF2 kinase or both.
Product Details
Description Full length Clone DNA of Mouse eukaryotic translation elongation factor 2 with C terminal HA tag.
NCBI Ref Seq NM_007907.2
RefSeq ORF Size 2577 bp
Vector pCMV3-C-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.