Edil3 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Edil3 cDNA ORF Clone, Mouse, untagged

Edil3 cDNA ORF Clone, Mouse, untagged

SPD-04808

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse EGF-like repeats and discoidin I-like domains 3.
Target Information
Species Mouse
Target Name EDIL3/DEL1
Gene Abbr. Edil3
Gene ID 13612
Full Name EGF-like repeats and discoidin I-like domains 3
Alias Del, Del-, Del-1, Del1, Sox2-cre
Introduction The protein encoded by this gene is an integrin ligand. It plays an important role in mediating angiogenesis and may be important in vessel wall remodeling and development. It also influences endothelial cell behavior. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Mouse EGF-like repeats and discoidin I-like domains 3.
NCBI Ref Seq NM_001037987.3
RefSeq ORF Size 1443 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.