EDA cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

EDA cDNA ORF Clone, Human, untagged

EDA cDNA ORF Clone, Human, untagged

SPD-04798

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human ectodysplasin A.
Target Information
Species Human
Target Name EDA
Gene Abbr. EDA
Gene ID 1896
Full Name ectodysplasin A
Alias ECTD1, ED1, ED1-A1, ED1-A2, EDA-A1
Product Details
Description Full length Clone DNA of Human ectodysplasin A.
NCBI Ref Seq BC126143
RefSeq ORF Size 1176 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.