Ecsit cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Ecsit cDNA ORF Clone, Mouse, untagged

Ecsit cDNA ORF Clone, Mouse, untagged

SPD-04778

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse ECSIT homolog (Drosophila)
Target Information
Species Mouse
Target Name ECSIT
Gene Abbr. Ecsit
Gene ID 26940
Full Name ECSIT signalling integrator
Alias Sit, Sitpec
Product Details
Description Full length Clone DNA of Mouse ECSIT homolog (Drosophila)
NCBI Ref Seq NM_012029.2
RefSeq ORF Size 1308 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.