Online Inquiry
Ebi3 cDNA ORF Clone, Rat, C-HA tag
SPD-04690
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat Epstein-Barr virus induced 3 with C terminal HA tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | EBI3 |
Gene Abbr. | Ebi3 |
Gene ID | 680609 |
Full Name | Epstein-Barr virus induced 3 |
Introduction | EBI3 (Epstein-Barr virus Induced-3) is a secreted glycoprotein of the hematopoietin receptor family. It plays a critical regulatory role in the induction of Th2-type immune responses and the development of Th2-mediated tissue inflammation in vivo, which may be mediated through the control of iNKT cell function. EBI3 dimerizes with p28 and p35 subunits of IL-12 to form new proteins IL-27 and IL-35, respectively (Honglian Tong et al, 2010). IL-27 is an early product of activated antigen presenting cell that is produced upon TLR ligation. It negatively regulates Th17 cell differentiation. EBI3 is widely expressed and its expression in dendritic cell is transcriptionally regulated by TLR signaling via MyD88 and NF-kappaB during innate immune responses preceding cytokine driven Th cell development. EBI3 signal inhibits delayed-type hypersensitivity responses by suppressing IL-17 production and inducing IL-10 hyperproduction. EBI3 may play a novel role in controlling tumor metastasis via lung CD8+ T cells, and its deficiency is associated with a diminished production of Th2 cytokines which are known to regulate allergic airway inflammation in asthma. Targeted deletion of EBI3 protects mice from lung metastasis (Kerstin A et al, 2008). |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat Epstein-Barr virus induced 3 with C terminal HA tag. |
NCBI Ref Seq | NM_001109421.1 |
RefSeq ORF Size | 687 bp |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.