Ebi3 cDNA ORF Clone, Rat, C-FLAG tag - CD BioSciences

service-banner

Ebi3 cDNA ORF Clone, Rat, C-FLAG tag

Ebi3 cDNA ORF Clone, Rat, C-FLAG tag

SPD-04687

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat Epstein-Barr virus induced 3 with C terminal Flag tag.
Target Information
Species Rat
Target Name EBI3
Gene Abbr. Ebi3
Gene ID 680609
Full Name Epstein-Barr virus induced 3
Introduction EBI3 (Epstein-Barr virus Induced-3) is a secreted glycoprotein of the hematopoietin receptor family. It plays a critical regulatory role in the induction of Th2-type immune responses and the development of Th2-mediated tissue inflammation in vivo, which may be mediated through the control of iNKT cell function. EBI3 dimerizes with p28 and p35 subunits of IL-12 to form new proteins IL-27 and IL-35, respectively (Honglian Tong et al, 2010). IL-27 is an early product of activated antigen presenting cell that is produced upon TLR ligation. It negatively regulates Th17 cell differentiation. EBI3 is widely expressed and its expression in dendritic cell is transcriptionally regulated by TLR signaling via MyD88 and NF-kappaB during innate immune responses preceding cytokine driven Th cell development. EBI3 signal inhibits delayed-type hypersensitivity responses by suppressing IL-17 production and inducing IL-10 hyperproduction. EBI3 may play a novel role in controlling tumor metastasis via lung CD8+ T cells, and its deficiency is associated with a diminished production of Th2 cytokines which are known to regulate allergic airway inflammation in asthma. Targeted deletion of EBI3 protects mice from lung metastasis (Kerstin A et al, 2008).
Product Details
Description Full length Clone DNA of Rat Epstein-Barr virus induced 3 with C terminal Flag tag.
NCBI Ref Seq NM_001109421.1
RefSeq ORF Size 687 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.