EBI3 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

EBI3 cDNA ORF Clone, Human, N-HA tag

EBI3 cDNA ORF Clone, Human, N-HA tag

SPD-04715

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human Epstein-Barr virus induced 3 (EBI3) with N terminal HA tag.
Target Information
Species Human
Target Name EBI3
Gene Abbr. EBI3
Gene ID 10148
Full Name Epstein-Barr virus induced 3
Alias IL-27B, IL27B, IL35B
Introduction EBI3 (Epstein-Barr virus Induced-3) is a secreted glycoprotein of the hematopoietin receptor family. It plays a critical regulatory role in the induction of Th2-type immune responses and the development of Th2-mediated tissue inflammation in vivo, which may be mediated through the control of iNKT cell function. EBI3 dimerizes with p28 and p35 subunits of IL-12 to form new proteins IL-27 and IL-35, respectively (Honglian Tong et al, 2010). IL-27 is an early product of activated antigen presenting cell that is produced upon TLR ligation. It negatively regulates Th17 cell differentiation. EBI3 is widely expressed and its expression in dendritic cell is transcriptionally regulated by TLR signaling via MyD88 and NF-kappaB during innate immune responses preceding cytokine driven Th cell development. EBI3 signal inhibits delayed-type hypersensitivity responses by suppressing IL-17 production and inducing IL-10 hyperproduction. EBI3 may play a novel role in controlling tumor metastasis via lung CD8+ T cells, and its deficiency is associated with a diminished production of Th2 cytokines which are known to regulate allergic airway inflammation in asthma. Targeted deletion of EBI3 protects mice from lung metastasis (Kerstin A et al, 2008).
Product Details
Description Full length Clone DNA of Human Epstein-Barr virus induced 3 (EBI3) with N terminal HA tag.
NCBI Ref Seq NM_005755.2
RefSeq ORF Size 720 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites HindIII + NotI (6kb + 0.72kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.